Orthologous regulated operons containing scrB gene
Regulog: | ScrR - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sucrose utilization |
Effector: | Sucrose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pseudoalteromonas atlantica T6c | ||||
Position: -155
Score: 6.29075 Sequence: AATCTTAAACGTTTAAGATG
Locus tag: Patl_3822
Name: Patl_3822 Funciton: Predicted sucrose transporter
Locus tag: Patl_3823
Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
||||
Patl_3822-scrB | -155 | 6.3 | AATCTTAAACGTTTAAGATG | Patl_3822 |