Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing RSc1791 gene

Properties
Regulog: PSPTO0485 - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/gamma
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas syringae pv. tomato str. DC3000
Position: -29
Score: 4.80416
Sequence: CAATGAGATCGATCTCAAAG
Locus tag: PSPTO0485
Name: PSPTO0485
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: PSPTO0486
Name: RSc1791
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: PSPTO0487
Name: RSc1792
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: PSPTO0488
Name: RSc1793
Funciton: ABC transporter, permease protein
Locus tag: PSPTO0489
Name: RSc1794
Funciton: ABC transporter, ATP-binding protein
Locus tag: PSPTO0490
Name: RSc1795
Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
PSPTO0485-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 -29 4.8 CAATGAGATCGATCTCAAAG PSPTO0485
© 2009-2020 RegPrecise