Orthologous regulated operons containing Bphy_6993 gene
| Regulog: | Bphy_6994 - Burkholderia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | NULL |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Burkholderia phymatum STM815 | ||||
|
Position: -101
Score: 6.60711 Sequence: TTACTGTATCGATACACTAA
Locus tag: Bphy_6992
Name: Bphy_6992 Funciton: Putative TRAP transporter, periplasmic protein
Locus tag: Bphy_6993
Name: Bphy_6993 Funciton: Putative TRAP transporter, permease protein
Locus tag: Bphy_6994
Name: Bphy_6994 Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Bphy_6995
Name: PF00389 Funciton: Putative phosphoglycerate dehydrogenase
Locus tag: Bphy_6996
Name: PF04909 Funciton: Amidohydrolase 2 |
||||
| Bphy_6992-Bphy_6993-Bphy_6994-PF00389-PF04909 | -101 | 6.6 | TTACTGTATCGATACACTAA | Bphy_6992 |
| Burkholderia sp. 383 | ||||
|
Position: -65
Score: 6.60711 Sequence: TTACTGTATCGATACACTAA
Locus tag: Bcep18194_B1309
Name: Bphy_6992 Funciton: Putative TRAP transporter, periplasmic protein
Locus tag: Bcep18194_B1310
Name: Bphy_6993 Funciton: Putative TRAP transporter, permease protein
Locus tag: Bcep18194_B1311
Name: Bphy_6994 Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Bcep18194_B1312
Name: PF00389 Funciton: Putative phosphoglycerate dehydrogenase
Locus tag: Bcep18194_B1313
Name: PF04909 Funciton: Amidohydrolase 2 |
||||
| Bphy_6992-Bphy_6993-Bphy_6994-PF00389-PF04909 | -65 | 6.6 | TTACTGTATCGATACACTAA | Bcep18194_B1309 |