Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Bphy_6992 gene

Properties
Regulog: Bphy_6994 - Burkholderia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: NULL
Effector:
Phylum: Proteobacteria/beta
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia phymatum STM815
Position: -101
Score: 6.60711
Sequence: TTACTGTATCGATACACTAA
Locus tag: Bphy_6992
Name: Bphy_6992
Funciton: Putative TRAP transporter, periplasmic protein
Locus tag: Bphy_6993
Name: Bphy_6993
Funciton: Putative TRAP transporter, permease protein
Locus tag: Bphy_6994
Name: Bphy_6994
Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Bphy_6995
Name: PF00389
Funciton: Putative phosphoglycerate dehydrogenase
Locus tag: Bphy_6996
Name: PF04909
Funciton: Amidohydrolase 2
Bphy_6992-Bphy_6993-Bphy_6994-PF00389-PF04909 -101 6.6 TTACTGTATCGATACACTAA Bphy_6992
Burkholderia sp. 383
Position: -65
Score: 6.60711
Sequence: TTACTGTATCGATACACTAA
Locus tag: Bcep18194_B1309
Name: Bphy_6992
Funciton: Putative TRAP transporter, periplasmic protein
Locus tag: Bcep18194_B1310
Name: Bphy_6993
Funciton: Putative TRAP transporter, permease protein
Locus tag: Bcep18194_B1311
Name: Bphy_6994
Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Bcep18194_B1312
Name: PF00389
Funciton: Putative phosphoglycerate dehydrogenase
Locus tag: Bcep18194_B1313
Name: PF04909
Funciton: Amidohydrolase 2
Bphy_6992-Bphy_6993-Bphy_6994-PF00389-PF04909 -65 6.6 TTACTGTATCGATACACTAA Bcep18194_B1309