Orthologous regulated operons containing Bphy_2241 gene

Properties
Regulog:	Bphy_2245 - Burkholderia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/beta

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Burkholderia phymatum STM815
Position: -107 Score: 7.42686 Sequence: GAATGTAATCGATTACATTT Locus tag: Bphy_2245 Name: Bphy_2245 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Bphy_2244 Name: Bphy_2244 Funciton: Monosaccharide ABC transporter, permease protein Locus tag: Bphy_2243 Name: Bphy_2243 Funciton: Monosaccharide ABC transporter, ATP-binding protein Locus tag: Bphy_2242 Name: Bphy_2242 Funciton: Monosaccharide ABC transporter, substrate-binding protein Locus tag: Bphy_2241 Name: Bphy_2241 Funciton: Predicted sugar isomerase Locus tag: Bphy_2240 Name: Bphy_2240 Funciton: Predicted sugar oxidoreductase
Bphy_2245-Bphy_2244-Bphy_2243-Bphy_2242-Bphy_2241-Bphy_2240	-107	7.4	GAATGTAATCGATTACATTT	Bphy_2245
Burkholderia xenovorans LB400
Position: -143 Score: 7.60951 Sequence: AAATGTAATCGATTACATTT Locus tag: Bxe_A3676 Name: Bphy_2245 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Bxe_A3675 Name: Bphy_2244 Funciton: Monosaccharide ABC transporter, permease protein Locus tag: Bxe_A3674 Name: Bphy_2243 Funciton: Monosaccharide ABC transporter, ATP-binding protein Locus tag: Bxe_A3673 Name: Bphy_2242 Funciton: Monosaccharide ABC transporter, substrate-binding protein Locus tag: Bxe_A3672 Name: Bphy_2241 Funciton: Predicted sugar isomerase Locus tag: Bxe_A3671 Name: Bphy_2240 Funciton: Predicted sugar oxidoreductase
Bphy_2245-Bphy_2244-Bphy_2243-Bphy_2242-Bphy_2241-Bphy_2240	-143	7.6	AAATGTAATCGATTACATTT	Bxe_A3676