Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Bphy_2245 gene

Properties
Regulog: Bphy_2245 - Burkholderia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia phymatum STM815
Position: -107
Score: 7.42686
Sequence: GAATGTAATCGATTACATTT
Locus tag: Bphy_2245
Name: Bphy_2245
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: Bphy_2244
Name: Bphy_2244
Funciton: Monosaccharide ABC transporter, permease protein
Locus tag: Bphy_2243
Name: Bphy_2243
Funciton: Monosaccharide ABC transporter, ATP-binding protein
Locus tag: Bphy_2242
Name: Bphy_2242
Funciton: Monosaccharide ABC transporter, substrate-binding protein
Locus tag: Bphy_2241
Name: Bphy_2241
Funciton: Predicted sugar isomerase
Locus tag: Bphy_2240
Name: Bphy_2240
Funciton: Predicted sugar oxidoreductase
Bphy_2245-Bphy_2244-Bphy_2243-Bphy_2242-Bphy_2241-Bphy_2240 -107 7.4 GAATGTAATCGATTACATTT Bphy_2245
Burkholderia xenovorans LB400
Position: -143
Score: 7.60951
Sequence: AAATGTAATCGATTACATTT
Locus tag: Bxe_A3676
Name: Bphy_2245
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: Bxe_A3675
Name: Bphy_2244
Funciton: Monosaccharide ABC transporter, permease protein
Locus tag: Bxe_A3674
Name: Bphy_2243
Funciton: Monosaccharide ABC transporter, ATP-binding protein
Locus tag: Bxe_A3673
Name: Bphy_2242
Funciton: Monosaccharide ABC transporter, substrate-binding protein
Locus tag: Bxe_A3672
Name: Bphy_2241
Funciton: Predicted sugar isomerase
Locus tag: Bxe_A3671
Name: Bphy_2240
Funciton: Predicted sugar oxidoreductase
Bphy_2245-Bphy_2244-Bphy_2243-Bphy_2242-Bphy_2241-Bphy_2240 -143 7.6 AAATGTAATCGATTACATTT Bxe_A3676