Orthologous regulated operons containing iolR2 gene
| Regulog: | IolR2 - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Inositol utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -73
Score: 6.27568 Sequence: CAATTGGAGCGCTCCAACAC
Locus tag: cg0210
Name: iolR2 Funciton: Transcriptional regulator for inositol utilization, LacI family |
||||
| iolR2 | -73 | 6.3 | CAATTGGAGCGCTCCAACAC | cg0210 |