Orthologous regulated operons containing iolE2 gene
| Regulog: | IolR2 - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Inositol utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -86
Score: 6.27568 Sequence: GTGTTGGAGCGCTCCAATTG
Locus tag: cg0211
Name: iolG2 Funciton: Inositol 2-dehydrogenase (EC 1.1.1.18 )
Locus tag: cg0212
Name: iolE2 Funciton: Inosose dehydratase (EC 4.2.1.44) |
||||
| iolG2-iolE2 | -86 | 6.3 | GTGTTGGAGCGCTCCAATTG | cg0211 |