Orthologous regulated operons containing SO0068 gene
| Regulog: | SO0072 - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella amazonensis SB2B | ||||
|
Position: -83
Score: 6.07634 Sequence: TGAATCACTGTATTAATACA
Position: -75
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Sama_3575
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sama_3576
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sama_3577
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sama_3578
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -83 | 6.1 | TGAATCACTGTATTAATACA | Sama_3575 |
| -75 | 7.1 | TGTATTAATACATTGATACA | ||
| Shewanella baltica OS155 | ||||
|
Position: -79
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Sbal_4278
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sbal_4279
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sbal_4280
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sbal_4281
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -79 | 7.1 | TGTATTAATACATTGATACA | Sbal_4278 |
| Shewanella denitrificans OS217 | ||||
|
Position: -73
Score: 6.86474 Sequence: TGTATTAATTCATTGATACA
Locus tag: Sden_0068
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sden_0067
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sden_0066
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sden_0065
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -73 | 6.9 | TGTATTAATTCATTGATACA | Sden_0068 |
| Shewanella frigidimarina NCIMB 400 | ||||
|
Position: -80
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Sfri_3977
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sfri_3978
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sfri_3979
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sfri_3980
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -80 | 7.1 | TGTATTAATACATTGATACA | Sfri_3977 |
| Shewanella loihica PV-4 | ||||
|
Position: -101
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Shew_3780
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Shew_3781
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Shew_3782
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Shew_3783
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -101 | 7.1 | TGTATTAATACATTGATACA | Shew_3780 |
| Shewanella oneidensis MR-1 | ||||
|
Position: -78
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: SO0071
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: SO0070
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: SO0069
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: SO0068
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -78 | 7.1 | TGTATTAATACATTGATACA | SO0071 |
| Shewanella pealeana ATCC 700345 | ||||
|
Position: -76
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Spea_4190
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Spea_4191
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Spea_4192
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Spea_4193
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -76 | 7.1 | TGTATTAATACATTGATACA | Spea_4190 |
| Shewanella putrefaciens CN-32 | ||||
|
Position: -79
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Sputcn32_0057
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sputcn32_0056
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sputcn32_0055
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sputcn32_0054
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -79 | 7.1 | TGTATTAATACATTGATACA | Sputcn32_0057 |
| Shewanella sp ANA-3 | ||||
|
Position: -78
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Shewana3_0076
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Shewana3_0075
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Shewana3_0074
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Shewana3_0073
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -78 | 7.1 | TGTATTAATACATTGATACA | Shewana3_0076 |
| Shewanella sp MR-4 | ||||
|
Position: -78
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Shewmr4_0074
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Shewmr4_0073
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Shewmr4_0072
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Shewmr4_0071
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -78 | 7.1 | TGTATTAATACATTGATACA | Shewmr4_0074 |
| Shewanella sp MR-7 | ||||
|
Position: -78
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Shewmr7_0072
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Shewmr7_0071
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Shewmr7_0070
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Shewmr7_0069
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -78 | 7.1 | TGTATTAATACATTGATACA | Shewmr7_0072 |
| Shewanella sp W3-18-1 | ||||
|
Position: -79
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Sputw3181_4021
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sputw3181_4022
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sputw3181_4023
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sputw3181_4024
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -79 | 7.1 | TGTATTAATACATTGATACA | Sputw3181_4021 |
| Shewanella woodyi ATCC 51908 | ||||
|
Position: -75
Score: 7.13616 Sequence: TGTATTAATACATTGATACA
Locus tag: Swoo_4864
Name: PF00561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Swoo_4865
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Swoo_4866
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Swoo_4867
Name: SO0068 Funciton: hypothetical protein |
||||
| PF00561-COG4555-COG1668-SO0068 | -75 | 7.1 | TGTATTAATACATTGATACA | Swoo_4864 |