Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing COG1668 gene

Properties
Regulog: SO0072 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Phylum: Proteobacteria/gamma
Built upon 29 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -83
Score: 6.07634
Sequence: TGAATCACTGTATTAATACA
Position: -75
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Sama_3575
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sama_3576
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sama_3577
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sama_3578
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -83 6.1 TGAATCACTGTATTAATACA Sama_3575
-75 7.1 TGTATTAATACATTGATACA
Shewanella baltica OS155
Position: -79
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Sbal_4278
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sbal_4279
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sbal_4280
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sbal_4281
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -79 7.1 TGTATTAATACATTGATACA Sbal_4278
Shewanella denitrificans OS217
Position: -73
Score: 6.86474
Sequence: TGTATTAATTCATTGATACA
Locus tag: Sden_0068
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sden_0067
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sden_0066
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sden_0065
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -73 6.9 TGTATTAATTCATTGATACA Sden_0068
Shewanella frigidimarina NCIMB 400
Position: -80
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Sfri_3977
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sfri_3978
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sfri_3979
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sfri_3980
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -80 7.1 TGTATTAATACATTGATACA Sfri_3977
Shewanella loihica PV-4
Position: -101
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Shew_3780
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Shew_3781
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Shew_3782
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Shew_3783
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -101 7.1 TGTATTAATACATTGATACA Shew_3780
Shewanella oneidensis MR-1
Position: -78
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: SO0071
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: SO0070
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: SO0069
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: SO0068
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -78 7.1 TGTATTAATACATTGATACA SO0071
Shewanella pealeana ATCC 700345
Position: -76
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Spea_4190
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Spea_4191
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Spea_4192
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Spea_4193
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -76 7.1 TGTATTAATACATTGATACA Spea_4190
Shewanella piezotolerans WP3
Position: -133
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: swp_0108
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: swp_0106
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: swp_0105
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
PF00561-COG4555-COG1668 -133 7.1 TGTATTAATACATTGATACA swp_0108
Shewanella putrefaciens CN-32
Position: -79
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Sputcn32_0057
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sputcn32_0056
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sputcn32_0055
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sputcn32_0054
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -79 7.1 TGTATTAATACATTGATACA Sputcn32_0057
Shewanella sp ANA-3
Position: -78
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Shewana3_0076
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Shewana3_0075
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Shewana3_0074
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Shewana3_0073
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -78 7.1 TGTATTAATACATTGATACA Shewana3_0076
Shewanella sp MR-4
Position: -78
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Shewmr4_0074
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Shewmr4_0073
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Shewmr4_0072
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Shewmr4_0071
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -78 7.1 TGTATTAATACATTGATACA Shewmr4_0074
Shewanella sp MR-7
Position: -78
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Shewmr7_0072
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Shewmr7_0071
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Shewmr7_0070
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Shewmr7_0069
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -78 7.1 TGTATTAATACATTGATACA Shewmr7_0072
Shewanella sp W3-18-1
Position: -79
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Sputw3181_4021
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Sputw3181_4022
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Sputw3181_4023
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Sputw3181_4024
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -79 7.1 TGTATTAATACATTGATACA Sputw3181_4021
Shewanella woodyi ATCC 51908
Position: -75
Score: 7.13616
Sequence: TGTATTAATACATTGATACA
Locus tag: Swoo_4864
Name: PF00561
Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: Swoo_4865
Name: COG4555
Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: Swoo_4866
Name: COG1668
Funciton: Predicted ABC-type Na+ efflux pump, permease component
Locus tag: Swoo_4867
Name: SO0068
Funciton: hypothetical protein
PF00561-COG4555-COG1668-SO0068 -75 7.1 TGTATTAATACATTGATACA Swoo_4864
© 2009-2020 RegPrecise