Orthologous regulated operons containing dpe gene
Regulog: | PsiR - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Psicose utilization |
Effector: | Psicose |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Agrobacterium tumefaciens str. C58 (Cereon) | ||||
Position: -288
Score: 6.40198 Sequence: TTGCACCATCGATTGTGCAG
Position: -266
Score: 5.81251 Sequence: TGGCAATATCGATTGTGCAT
Locus tag: Atu4744
Name: psiA Funciton: Predicted psicose ABC transporter, substrate-binding protein
Locus tag: Atu4745
Name: psiB Funciton: Predicted psicose ABC transporter, ATP-binding protein
Locus tag: Atu4746
Name: psiC Funciton: Predicted psicose ABC transporter, inner membrane protein
Locus tag: Atu4747
Name: psiD Funciton: Predicted psicose ABC transporter, inner membrane protein
Locus tag: Atu4748
Name: psiE Funciton: Fructose:psicose-3-epimerase (EC 5.3.1.-)
Locus tag: Atu4749
Name: frcK Funciton: Fructokinase FrcK (EC 2.7.1.4)
Locus tag: Atu4750
Name: dpe Funciton: D-psicose 3-epimerase |
||||
psiA-psiB-psiC-psiD-psiE-frcK-dpe | -288 | 6.4 | TTGCACCATCGATTGTGCAG | Atu4744 |
-266 | 5.8 | TGGCAATATCGATTGTGCAT |