Orthologous regulated operons containing fucA gene
| Regulog: | PsiR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Psicose utilization |
| Effector: | Psicose |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhizobium sp. NGR234 | ||||
|
Position: -173
Score: 6.64981 Sequence: TTGCACCATCGATTGTGCAA
Position: -151
Score: 5.18165 Sequence: AAGAAATATCGATTGTGCAG
Locus tag: NGR_b11530
Name: psiA Funciton: Predicted psicose ABC transporter, substrate-binding protein
Locus tag: NGR_b11540
Name: psiB Funciton: Predicted psicose ABC transporter, ATP-binding protein
Locus tag: NGR_b11550
Name: psiC Funciton: Predicted psicose ABC transporter, inner membrane protein
Locus tag: NGR_b11560
Name: psiD Funciton: Predicted psicose ABC transporter, inner membrane protein
Locus tag: NGR_b11570
Name: psiE Funciton: Fructose:psicose-3-epimerase (EC 5.3.1.-)
Locus tag: NGR_b11580
Name: psiK Funciton: Predicted fructokinase, FGGY family
Locus tag: NGR_b11590
Name: fucA Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
||||
| psiA-psiB-psiC-psiD-psiE-psiK-fucA | -173 | 6.6 | TTGCACCATCGATTGTGCAA | NGR_b11530 |
| -151 | 5.2 | AAGAAATATCGATTGTGCAG | ||
| Sinorhizobium meliloti 1021 | ||||
|
Position: -173
Score: 6.64981 Sequence: TTGCACCATCGATTGTGCAA
Position: -151
Score: 5.42948 Sequence: AAGAAATATCGATTGTGCAA
Locus tag: SMb20484
Name: psiA Funciton: Predicted psicose ABC transporter, substrate-binding protein
Locus tag: SMb20485
Name: psiB Funciton: Predicted psicose ABC transporter, ATP-binding protein
Locus tag: SMb20486
Name: psiC Funciton: Predicted psicose ABC transporter, inner membrane protein
Locus tag: SMb20487
Name: psiD Funciton: Predicted psicose ABC transporter, inner membrane protein
Locus tag: SMb20488
Name: psiE Funciton: Fructose:psicose-3-epimerase (EC 5.3.1.-)
Locus tag: SMb20489
Name: psiK Funciton: Predicted fructokinase, FGGY family
Locus tag: SMb20490
Name: fucA2 Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
||||
| psiA-psiB-psiC-psiD-psiE-psiK-fucA2 | -173 | 6.6 | TTGCACCATCGATTGTGCAA | SMb20484 |
| -151 | 5.4 | AAGAAATATCGATTGTGCAA | ||