Orthologous regulated operons containing psiR gene
| Regulog: | PsiR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Psicose utilization |
| Effector: | Psicose |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -116
Score: 5.81251 Sequence: ATGCACAATCGATATTGCCA
Position: -94
Score: 6.40198 Sequence: CTGCACAATCGATGGTGCAA
Locus tag: Atu4743
Name: psiR Funciton: Predicted transcriptional regulator for psicose utilization, LacI family |
||||
| psiR | -116 | 5.8 | ATGCACAATCGATATTGCCA | Atu4743 |
| -94 | 6.4 | CTGCACAATCGATGGTGCAA | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -116
Score: 5.27024 Sequence: TTGCACAATCGATCTTTCTT
Position: -94
Score: 6.64981 Sequence: TTGCACAATCGATGGTGCAA
Locus tag: pRL120189
Name: psiR Funciton: Predicted transcriptional regulator for psicose utilization, LacI family |
||||
| psiR | -116 | 5.3 | TTGCACAATCGATCTTTCTT | pRL120189 |
| -94 | 6.6 | TTGCACAATCGATGGTGCAA | ||
| Rhizobium sp. NGR234 | ||||
|
Position: -109
Score: 5.18165 Sequence: CTGCACAATCGATATTTCTT
Position: -87
Score: 6.64981 Sequence: TTGCACAATCGATGGTGCAA
Locus tag: NGR_b11520
Name: psiR Funciton: Predicted transcriptional regulator for psicose utilization, LacI family |
||||
| psiR | -109 | 5.2 | CTGCACAATCGATATTTCTT | NGR_b11520 |
| -87 | 6.6 | TTGCACAATCGATGGTGCAA | ||
| Sinorhizobium meliloti 1021 | ||||
|
Position: -142
Score: 5.42948 Sequence: TTGCACAATCGATATTTCTT
Position: -120
Score: 6.64981 Sequence: TTGCACAATCGATGGTGCAA
Locus tag: SMb20483
Name: psiR Funciton: Predicted transcriptional regulator for psicose utilization, LacI family |
||||
| psiR | -142 | 5.4 | TTGCACAATCGATATTTCTT | SMb20483 |
| -120 | 6.6 | TTGCACAATCGATGGTGCAA | ||