Orthologous regulated operons containing rhiN gene

Properties
Regulog:	RhiR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Rhamnogalacturonides utilization
Effector:	Rhamogalacturonate oligosaccharides
Phylum:	Proteobacteria/Alpha

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -183 Score: 6.22034 Sequence: CAATGAAAACATTTTCACAA Position: -43 Score: 6.24835 Sequence: TCGTGAAAATAATTTCATTA Locus tag: Atu4562 Name: rhiX Funciton: hypothetical protein Locus tag: Atu4561 Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) Locus tag: Atu4560 Name: pgl Funciton: Polygalacturonase (EC 3.2.1.15) Locus tag: Atu4559 Name: rhiK Funciton: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein Locus tag: Atu4558 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: Atu4557 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiX-rhiN-pgl-rhiK-rhiG-rhiF	-183	6.2	CAATGAAAACATTTTCACAA	Atu4562
	-43	6.2	TCGTGAAAATAATTTCATTA
Rhizobium etli CFN 42
Position: -214 Score: 6.19535 Sequence: CCATGAAAACATTTTCATCA Position: -73 Score: 5.93598 Sequence: GAATGAAAAGATTTTCATGC Locus tag: RHE_PF00296 Name: rhiX Funciton: hypothetical protein Locus tag: RHE_PF00295 Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) Locus tag: RHE_PF00294 Name: pgl Funciton: Polygalacturonase (EC 3.2.1.15) Locus tag: RHE_PF00293 Name: rhiK Funciton: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein Locus tag: RHE_PF00292 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: RHE_PF00291 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiX-rhiN-pgl-rhiK-rhiG-rhiF	-214	6.2	CCATGAAAACATTTTCATCA	RHE_PF00296
	-73	5.9	GAATGAAAAGATTTTCATGC
Rhizobium leguminosarum bv. viciae 3841
Position: -180 Score: 6.45561 Sequence: CCATGAAAACATTTTCATTA Position: -40 Score: 6.53264 Sequence: TAATGAAAATATTTTCATAG Locus tag: pRL120686 Name: rhiX Funciton: hypothetical protein Locus tag: pRL120687 Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) Locus tag: pRL120688 Name: pgl Funciton: Polygalacturonase (EC 3.2.1.15) Locus tag: pRL120689 Name: rhiK Funciton: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein Locus tag: pRL120690 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: pRL120691 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiX-rhiN-pgl-rhiK-rhiG-rhiF	-180	6.5	CCATGAAAACATTTTCATTA	pRL120686
	-40	6.5	TAATGAAAATATTTTCATAG
Rhizobium sp. NGR234
Position: -182 Score: 5.90161 Sequence: TCATGAAAACTTTTTCATAA Position: -39 Score: 5.99589 Sequence: TGATGAAAACATTTTCATAC Locus tag: NGR_b17680 Name: rhiX Funciton: hypothetical protein Locus tag: NGR_b17690 Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) Locus tag: NGR_b17700 Name: pgl Funciton: Polygalacturonase (EC 3.2.1.15) Locus tag: NGR_b17710 Name: rhiK Funciton: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein Locus tag: NGR_b17720 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: NGR_b17730 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiX-rhiN-pgl-rhiK-rhiG-rhiF	-182	5.9	TCATGAAAACTTTTTCATAA	NGR_b17680
	-39	6	TGATGAAAACATTTTCATAC