Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing socM gene

Properties
Regulog: SocR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Santhopine utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodobacter sphaeroides 2.4.1
Position: -72
Score: 5.73012
Sequence: GTATGAGATCGGTCTCTCAG
Locus tag: RSP_3940
Name: socL
Funciton: Fructosyl-amino acid phosphate deglycase (EC 3.5.-.-)
Locus tag: RSP_3941
Name: socO
Funciton: Opine ABC transporter, substrate-binding protein
Locus tag: RSP_3942
Name: socN
Funciton: Opine ABC transporter, inner membrane protein
Locus tag: RSP_3943
Name: socM
Funciton: Opine ABC transporter, substrate-binding protein
Locus tag: RSP_3944
Name: socE
Funciton: Putative fructosyl-amino acid phosphate epimerase
Locus tag: RSP_3945
Name: socK
Funciton: Uncharacterized carbohydrate kinase in opine catabolism, PfkB
Locus tag: RSP_3946
Name: socD
Funciton: Fructosyl-amino acid oxidase (EC 1.5.3.-)
Locus tag: RSP_3948
Name: socQ
Funciton: Opine ABC transporter, ATP-binding protein
socL-socO-socN-socM-socE-socK-socD-socQ -72 5.7 GTATGAGATCGGTCTCTCAG RSP_3940
© 2009-2020 RegPrecise