Orthologous regulated operons containing socN gene
| Regulog: | SocR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Santhopine utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | ||||
|
Position: -72
Score: 5.73012 Sequence: GTATGAGATCGGTCTCTCAG
Locus tag: RSP_3940
Name: socL Funciton: Fructosyl-amino acid phosphate deglycase (EC 3.5.-.-)
Locus tag: RSP_3941
Name: socO Funciton: Opine ABC transporter, substrate-binding protein
Locus tag: RSP_3942
Name: socN Funciton: Opine ABC transporter, inner membrane protein
Locus tag: RSP_3943
Name: socM Funciton: Opine ABC transporter, substrate-binding protein
Locus tag: RSP_3944
Name: socE Funciton: Putative fructosyl-amino acid phosphate epimerase
Locus tag: RSP_3945
Name: socK Funciton: Uncharacterized carbohydrate kinase in opine catabolism, PfkB
Locus tag: RSP_3946
Name: socD Funciton: Fructosyl-amino acid oxidase (EC 1.5.3.-)
Locus tag: RSP_3948
Name: socQ Funciton: Opine ABC transporter, ATP-binding protein |
||||
| socL-socO-socN-socM-socE-socK-socD-socQ | -72 | 5.7 | GTATGAGATCGGTCTCTCAG | RSP_3940 |