Orthologous regulated operons containing socC gene
| Regulog: | SocR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Santhopine utilization |
| Effector: | Mannopine; Deoxyfructosyl glutamine |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -162
Score: 6.2698 Sequence: CAAAGAGACCGGTCTCATTC
Position: -141
Score: 6.0005 Sequence: CATTGAGACCGGTCTCAGTA
Locus tag: Atu5006
Name: socA Funciton: Deoxyfructosyl glutamine and mannopine ABC transporter, periplasmic amino acid-binding protein
Locus tag: Atu5005
Name: socB Funciton: Deoxyfructosyl glutamine and mannopine ABC transporter, ATP-binding protein fused to permease component
Locus tag: Atu5004
Name: socC Funciton: NAD-depending oxidoreductase involved in deoxyfructosyl glutamine utilization
Locus tag: Atu5003
Name: socD Funciton: Fructosyl-amino acid oxidase (EC 1.5.3.-) |
||||
| socA-socB-socC-socD | -162 | 6.3 | CAAAGAGACCGGTCTCATTC | Atu5006 |
| -141 | 6 | CATTGAGACCGGTCTCAGTA | ||