Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing susC_Ara-1 gene

Properties
Regulog: HTCS_Ara-1 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: activator
Biological process: Arabinan utilization
Effector: Arabinan
Phylum: Bacteroidetes
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides thetaiotaomicron VPI-5482
Position: -136
Score: 7.55285
Sequence: TATCCACCTCGAAAATTCATTTGTCCACCT
Locus tag: BT0365
Name: lamG
Funciton: Concanavalin A-like lectins/glucanases superfamily
Locus tag: BT0364
Name: susC_Ara-1
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BT0363
Name: susD-Ara-1
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BT0362
Name: susC_Ara-2
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BT0361
Name: susD_Ara-2
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BT0360
Name: abn1
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
lamG-susC_Ara-1-susD-Ara-1-susC_Ara-2-susD_Ara-2-abn1 -136 7.6 TATCCACCTCGAAAATTCATTTGTCCACCT BT0365