Orthologous regulated operons containing susD_Ara-3 gene

Properties
Regulog:	HTCS_Ara-1 - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	[Other]
Regulation mode:	activator
Biological process:	Arabinan utilization
Effector:	Arabinan
Phylum:	Bacteroidetes

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides dorei DSM 17855
Position: -291 Score: 7.50156 Sequence: CGTCCACCCTATAAAACCGTTTGTCCACCC Locus tag: BACDOR_01719 Name: susC_Ara-3 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides Locus tag: BACDOR_01720 Name: susD_Ara-3 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides Locus tag: BACDOR_01721 Name: null Funciton: hypothetical protein Locus tag: BACDOR_01722 Name: abn3 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
susC_Ara-3-susD_Ara-3-BACDOR_01721-abn3	-291	7.5	CGTCCACCCTATAAAACCGTTTGTCCACCC	BACDOR_01719
Bacteroides eggerthii DSM 20697
Position: -349 Score: 6.41777 Sequence: TCTCTACACTTAAAATTCGTTTATCCACCT Position: -328 Score: 7.33924 Sequence: TATCCACCTCTAAAACCCATTTGTCCACCC Locus tag: BACEGG_01540 Name: susC_Ara-3 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides Locus tag: BACEGG_01539 Name: susD_Ara-3 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides Locus tag: BACEGG_01538 Name: null Funciton: hypothetical protein Locus tag: BACEGG_01537 Name: abn3 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
susC_Ara-3-susD_Ara-3-BACEGG_01538-abn3	-349	6.4	TCTCTACACTTAAAATTCGTTTATCCACCT	BACEGG_01540
	-328	7.3	TATCCACCTCTAAAACCCATTTGTCCACCC
Bacteroides plebeius DSM 17135
Position: -224 Score: 7.76473 Sequence: TATCCACCTATAAAATTCGTTTGTCCACCT Locus tag: BACPLE_00643 Name: susC_Ara-3 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides Locus tag: BACPLE_00644 Name: susD_Ara-3 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides Locus tag: BACPLE_00645 Name: null Funciton: hypothetical protein Locus tag: BACPLE_00646 Name: abn3 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
susC_Ara-3-susD_Ara-3-BACPLE_00645-abn3	-224	7.8	TATCCACCTATAAAATTCGTTTGTCCACCT	BACPLE_00643
Bacteroides vulgatus ATCC 8482
Position: -265 Score: 7.50156 Sequence: CGTCCACCCTATAAAACCGTTTGTCCACCC Locus tag: BVU_1005 Name: susC_Ara-3 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides Locus tag: BVU_1006 Name: susD_Ara-3 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides Locus tag: BVU_1007 Name: null Funciton: hypothetical protein Locus tag: BVU_1008 Name: abn3 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
susC_Ara-3-susD_Ara-3-BVU_1007-abn3	-265	7.5	CGTCCACCCTATAAAACCGTTTGTCCACCC	BVU_1005