Orthologous regulated operons containing bfrH gene

Properties
Regulog:	BfrR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Phylum:	Firmicutes

Built upon 1 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus acidophilus NCFM
Position: -28 Score: 6.35496 Sequence: AAATTGAAACGTTTCAAAAG Locus tag: LBA0502 Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein Locus tag: LBA0503 Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1 Locus tag: LBA0504 Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2 Locus tag: LBA0505 Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) Locus tag: LBA0506 Name: bfrH Funciton: Fructooligosaccharides ABC transporter, ATP-binding protein Locus tag: LBA0507 Name: bfrP Funciton: Predicted fructooligosaccharides phosphorylase
bfrE-bfrF-bfrG-bfrA-bfrH-bfrP	-28	6.4	AAATTGAAACGTTTCAAAAG	LBA0502

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --