Orthologous regulated operons containing bfrP gene
| Regulog: | BfrR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactobacillus acidophilus NCFM | ||||
|
Position: -28
Score: 6.35496 Sequence: AAATTGAAACGTTTCAAAAG
Locus tag: LBA0502
Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: LBA0503
Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: LBA0504
Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: LBA0505
Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26)
Locus tag: LBA0506
Name: bfrH Funciton: Fructooligosaccharides ABC transporter, ATP-binding protein
Locus tag: LBA0507
Name: bfrP Funciton: Predicted fructooligosaccharides phosphorylase |
||||
| bfrE-bfrF-bfrG-bfrA-bfrH-bfrP | -28 | 6.4 | AAATTGAAACGTTTCAAAAG | LBA0502 |