Orthologous regulated operons containing ydbA gene
| Regulog: | YjdR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MarR |
| Regulation mode: | |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||||
|
Position: -55
Score: 6.37238 Sequence: ATAGTTATCCAGAGAACTAA
Locus tag: SDEG_1978
Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
Locus tag: SDEG_1977
Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
Locus tag: SDEG_1976
Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein |
||||
| yjdR-ydaG-ydbA | -55 | 6.4 | ATAGTTATCCAGAGAACTAA | SDEG_1978 |
| Streptococcus pyogenes M1 GAS | ||||
|
Position: -282
Score: 6.37238 Sequence: ATAGTTATCTAGAGAACTAA
Locus tag: SPy0228
Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
Locus tag: SPy0229
Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
Locus tag: SPy0230
Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein |
||||
| yjdR-ydaG-ydbA | -282 | 6.4 | ATAGTTATCTAGAGAACTAA | SPy0228 |
| Streptococcus suis 05ZYH33 | ||||
|
Position: -61
Score: 6.56967 Sequence: ATAGTTCTTAAGAGAACTAT
Position: -40
Score: 5.90529 Sequence: ATAGTTCTCATGGTAATTAT
Locus tag: SSU05_2039
Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
Locus tag: SSU05_2038
Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
Locus tag: SSU05_2037
Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
Locus tag: SSU05_2036
Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein |
||||
| yjdR-ydaG-ydbA-ydbA | -61 | 6.6 | ATAGTTCTTAAGAGAACTAT | SSU05_2039 |
| -40 | 5.9 | ATAGTTCTCATGGTAATTAT | ||
| Streptococcus uberis 0140J | ||||
|
Position: -51
Score: 6.46661 Sequence: ATAGTTCTCTTAAGAACTAA
Position: -30
Score: 5.90734 Sequence: ATGGTTTTCACGAGAACTAA
Locus tag: SUB1690
Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
Locus tag: SUB1689
Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
Locus tag: SUB1688
Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein |
||||
| yjdR-ydaG-ydbA | -51 | 6.5 | ATAGTTCTCTTAAGAACTAA | SUB1690 |
| -30 | 5.9 | ATGGTTTTCACGAGAACTAA | ||