Orthologous regulated operons containing ydbA gene

Properties
Regulog:	YjdR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	MarR
Regulation mode:
Biological process:	Multidrug resistance
Effector:
Phylum:	Firmicutes

Built upon 21 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -55 Score: 6.37238 Sequence: ATAGTTATCCAGAGAACTAA Locus tag: SDEG_1978 Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family Locus tag: SDEG_1977 Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SDEG_1976 Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
yjdR-ydaG-ydbA	-55	6.4	ATAGTTATCCAGAGAACTAA	SDEG_1978
Streptococcus pyogenes M1 GAS
Position: -282 Score: 6.37238 Sequence: ATAGTTATCTAGAGAACTAA Locus tag: SPy0228 Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family Locus tag: SPy0229 Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SPy0230 Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
yjdR-ydaG-ydbA	-282	6.4	ATAGTTATCTAGAGAACTAA	SPy0228
Streptococcus suis 05ZYH33
Position: -61 Score: 6.56967 Sequence: ATAGTTCTTAAGAGAACTAT Position: -40 Score: 5.90529 Sequence: ATAGTTCTCATGGTAATTAT Locus tag: SSU05_2039 Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family Locus tag: SSU05_2038 Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SSU05_2037 Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SSU05_2036 Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
yjdR-ydaG-ydbA-ydbA	-61	6.6	ATAGTTCTTAAGAGAACTAT	SSU05_2039
	-40	5.9	ATAGTTCTCATGGTAATTAT
Streptococcus uberis 0140J
Position: -51 Score: 6.46661 Sequence: ATAGTTCTCTTAAGAACTAA Position: -30 Score: 5.90734 Sequence: ATGGTTTTCACGAGAACTAA Locus tag: SUB1690 Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family Locus tag: SUB1689 Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SUB1688 Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
yjdR-ydaG-ydbA	-51	6.5	ATAGTTCTCTTAAGAACTAA	SUB1690
	-30	5.9	ATGGTTTTCACGAGAACTAA