Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing paaC gene

Properties
Regulog: PaaR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Betaproteobacteria
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Delftia acidovorans SPH-1
Position: -63
Score: 4.56736
Sequence: ATAATCCTACCGTCCGGTCGGT
Position: -59
Score: 5.72992
Sequence: TCCTACCGTCCGGTCGGTCAAT
Locus tag: Daci_0809
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Daci_0810
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Daci_0811
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Daci_0812
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Daci_0813
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Daci_0814
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaK-paaA-paaB-paaC-paaD-paaE -63 4.6 ATAATCCTACCGTCCGGTCGGT Daci_0809
-59 5.7 TCCTACCGTCCGGTCGGTCAAT
Leptothrix cholodnii SP-6
Position: -48
Score: 6.29162
Sequence: ATTTACCGACCGGACGGTCAAT
Locus tag: Lcho_3574
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Lcho_3573
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Lcho_3572
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Lcho_3571
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Lcho_3570
Name: null
Funciton: hypothetical protein
Locus tag: Lcho_3569
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Lcho_3568
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaA-paaB-paaC-paaD-Lcho_3570-paaE-paaZ -48 6.3 ATTTACCGACCGGACGGTCAAT Lcho_3574
Methylibium petroleiphilum PM1
Position: -85
Score: 5.66643
Sequence: GTCTACCGACTGGTCGGTCAAT
Locus tag: Mpe_A0984
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Mpe_A0985
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Mpe_A0986
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Mpe_A0987
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Mpe_A0988
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Mpe_A0989
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Mpe_A0990
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Mpe_A0991
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Mpe_A0992
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-paaR -85 5.7 GTCTACCGACTGGTCGGTCAAT Mpe_A0984
Variovorax paradoxus S110
Position: -52
Score: 4.62868
Sequence: TAAAATCTACCGGACGGTCGGT
Position: -48
Score: 5.49521
Sequence: ATCTACCGGACGGTCGGTCAAT
Locus tag: Vapar_1238
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Vapar_1237
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Vapar_1236
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Vapar_1235
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Vapar_1234
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Vapar_1233
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Vapar_1232
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Vapar_1231
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Vapar_1230
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Vapar_1229
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Vapar_1228
Name: livM
Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
Locus tag: Vapar_1227
Name: livF
Funciton: Putative branched-chain amino acid ABC transporter, permease component 2
Locus tag: Vapar_1226
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-livK-livH-livM-livF-paaZ -52 4.6 TAAAATCTACCGGACGGTCGGT Vapar_1238
-48 5.5 ATCTACCGGACGGTCGGTCAAT
Verminephrobacter eiseniae EF01-2
Position: -102
Score: 5.49521
Sequence: ATCTACCGCACGGTCGGTCAAT
Locus tag: Veis_3942
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Veis_3943
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Veis_3944
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Veis_3945
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Veis_3946
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Veis_3947
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Veis_3948
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Veis_3949
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Veis_3950
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Veis_3951
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Veis_3952
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Veis_3953
Name: livM
Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-paaR-livK-livH-livM -102 5.5 ATCTACCGCACGGTCGGTCAAT Veis_3942