Orthologous regulated operons containing paaA gene

Properties
Regulog:	PaaR - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Betaproteobacteria

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Delftia acidovorans SPH-1
Position: -63 Score: 4.56736 Sequence: ATAATCCTACCGTCCGGTCGGT Position: -59 Score: 5.72992 Sequence: TCCTACCGTCCGGTCGGTCAAT Locus tag: Daci_0809 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Daci_0810 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Daci_0811 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Daci_0812 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Daci_0813 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Daci_0814 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaK-paaA-paaB-paaC-paaD-paaE	-63	4.6	ATAATCCTACCGTCCGGTCGGT	Daci_0809
	-59	5.7	TCCTACCGTCCGGTCGGTCAAT
Leptothrix cholodnii SP-6
Position: -48 Score: 6.29162 Sequence: ATTTACCGACCGGACGGTCAAT Locus tag: Lcho_3574 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Lcho_3573 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Lcho_3572 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Lcho_3571 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Lcho_3570 Name: null Funciton: hypothetical protein Locus tag: Lcho_3569 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Lcho_3568 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaA-paaB-paaC-paaD-Lcho_3570-paaE-paaZ	-48	6.3	ATTTACCGACCGGACGGTCAAT	Lcho_3574
Methylibium petroleiphilum PM1
Position: -85 Score: 5.66643 Sequence: GTCTACCGACTGGTCGGTCAAT Locus tag: Mpe_A0984 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Mpe_A0985 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Mpe_A0986 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Mpe_A0987 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Mpe_A0988 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Mpe_A0989 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Mpe_A0990 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Mpe_A0991 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Mpe_A0992 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-paaR	-85	5.7	GTCTACCGACTGGTCGGTCAAT	Mpe_A0984
Variovorax paradoxus S110
Position: -52 Score: 4.62868 Sequence: TAAAATCTACCGGACGGTCGGT Position: -48 Score: 5.49521 Sequence: ATCTACCGGACGGTCGGTCAAT Locus tag: Vapar_1238 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Vapar_1237 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Vapar_1236 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Vapar_1235 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Vapar_1234 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Vapar_1233 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Vapar_1232 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Vapar_1231 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Vapar_1230 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: Vapar_1229 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: Vapar_1228 Name: livM Funciton: Putative branched-chain amino acid ABC transporter, ATPase component Locus tag: Vapar_1227 Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2 Locus tag: Vapar_1226 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-livK-livH-livM-livF-paaZ	-52	4.6	TAAAATCTACCGGACGGTCGGT	Vapar_1238
	-48	5.5	ATCTACCGGACGGTCGGTCAAT
Verminephrobacter eiseniae EF01-2
Position: -102 Score: 5.49521 Sequence: ATCTACCGCACGGTCGGTCAAT Locus tag: Veis_3942 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Veis_3943 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Veis_3944 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Veis_3945 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Veis_3946 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Veis_3947 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Veis_3948 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Veis_3949 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Veis_3950 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family Locus tag: Veis_3951 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: Veis_3952 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: Veis_3953 Name: livM Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-paaR-livK-livH-livM	-102	5.5	ATCTACCGCACGGTCGGTCAAT	Veis_3942