Regulon of DVU2423 in Desulfohalobium retbaense DSM 5692

Properties
Regulator type:	Transcription factor
TF locus tag:	Dret_0703
Regulator family:	HxlR
Regulation mode:
Biological process:	Nitrogen metabolism
Effector:
Regulog:	DVU2423 - Desulfovibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - HxlR
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -143 Score: 4.1 Sequence: GTGTGCCCTGCTTTGCATAC Locus tag: Dret_0703 Name: null Funciton: Transcriptional regulator, HxlR family
	Dret_0703		Transcriptional regulator, HxlR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD