Regulon of DVU2423 in Desulfovibrio magneticus RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	DMR_35240
Regulator family:	HxlR
Regulation mode:
Biological process:	Nitrogen metabolism
Effector:
Regulog:	DVU2423 - Desulfovibrionales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - HxlR
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5 Sequence: TAGTATCCTTTTGGATACCA Locus tag: DMR_35240 Name: null Funciton: Transcriptional regulator, HxlR family
	DMR_35240		Transcriptional regulator, HxlR family
Position: -106 Score: 5 Sequence: TGGTATCCAAAAGGATACTA Locus tag: DMR_35230 Name: DVU2422 Funciton: Nitroreductase family protein Locus tag: DMR_35220 Name: flr Funciton: Flavoredoxin Locus tag: DMR_35210 Name: null Funciton: putative flavoredoxin Locus tag: DMR_35200 Name: null Funciton: NADPH-dependent FMN reductase
	DMR_35230	DVU2422	Nitroreductase family protein
	DMR_35220	flr	Flavoredoxin
	DMR_35210		putative flavoredoxin
	DMR_35200		NADPH-dependent FMN reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD