Regulon of DVU2423 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU2423
Regulator family:	HxlR
Regulation mode:
Biological process:	Nitrogen metabolism
Effector:
Regulog:	DVU2423 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - HxlR
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -19 Score: 5.3 Sequence: TTGTACCCTAGAGGATACCA Locus tag: DVU2423 Name: null Funciton: Transcriptional regulator, HxlR family
	DVU2423		Transcriptional regulator, HxlR family
Position: -102 Score: 5.3 Sequence: TGGTATCCTCTAGGGTACAA Locus tag: DVU2422 Name: DVU2422 Funciton: Nitroreductase family protein Locus tag: DVU2421 Name: dmpI Funciton: 4-oxalocrotonate tautomerase (EC 5.3.2.-) Locus tag: DVU2420 Name: null Funciton: conserved hypothetical protein
	DVU2422	DVU2422	Nitroreductase family protein
	DVU2421	dmpI	4-oxalocrotonate tautomerase (EC 5.3.2.-)
	DVU2420		conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD