Regulon of BgrT7 in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_1669
Regulator family:	TetR
Regulation mode:
Biological process:	Galactosides utilization
Effector:
Regulog:	BgrT7 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - TetR
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -148 Score: 5.2 Sequence: AAGTTATCAACCAGTAAGTT Position: -133 Score: 4.8 Sequence: AAGTTACTAGTTAGTAATCA Position: -126 Score: 5.5 Sequence: TAGTTAGTAATCAATAACAA Locus tag: BDP_1668 Name: BDP_1668 Funciton: Hypothetical protein Locus tag: BDP_1667 Name: lacS Funciton: Galactoside symporter
	BDP_1668	BDP_1668	Hypothetical protein
	BDP_1667	lacS	Galactoside symporter
Position: -167 Score: 5.2 Sequence: TGGTTACTACCAGATAACTT Position: -145 Score: 5.6 Sequence: AAGTTAGCTACCGATAACTT Position: -52 Score: 5.2 Sequence: TAATTATTAATTGGTAACTT Locus tag: BDP_1669 Name: bgrT7 Funciton: Predicted beta-galactoside specific transcriptional regulator, TetR family
	BDP_1669	bgrT7	Predicted beta-galactoside specific transcriptional regulator, TetR family
Position: -199 Score: 5.2 Sequence: AAGTTACCAATTAATAATTA Position: -106 Score: 5.6 Sequence: AAGTTATCGGTAGCTAACTT Position: -84 Score: 5.2 Sequence: AAGTTATCTGGTAGTAACCA Locus tag: BDP_1670 Name: bgaT2 Funciton: Predicted beta-galactoside permease, MFS family
	BDP_1670	bgaT2	Predicted beta-galactoside permease, MFS family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD