Regulon of BLA_0357 in Bifidobacterium angulatum DSM 20098

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFANG_00714
Regulator family:	ROK
Regulation mode:
Biological process:	Galactooligosaccharide utilization
Effector:
Regulog:	BLA_0357 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By pathway - Galactooligosaccharide utilization

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 6 Sequence: TTTTCGAAAGTAGTTTTGTAAAA Locus tag: BIFANG_00714 Name: BLA_0357 Funciton: Transcriptional regulator, ROK family
	BIFANG_00714	BLA_0357	Transcriptional regulator, ROK family
Position: -76 Score: 6.2 Sequence: TTTTGCAAATCTGTTTTCTTAAA Locus tag: BIFANG_00707 Name: glgX Funciton: Glycogen debranching enzyme (EC 3.2.1.-)
	BIFANG_00707	glgX	Glycogen debranching enzyme (EC 3.2.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD