Regulon of FruR in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_01709
Regulator family:	ROK
Regulation mode:
Biological process:	Fructose utilization
Effector:
Regulog:	FruR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By pathway - Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 7 Sequence: ATAGATTAACTACGTTAATATCT Locus tag: BIFBRE_01709 Name: fruR Funciton: Transcriptional regulator of fructose utilization, ROK family Locus tag: BIFBRE_01710 Name: fruK Funciton: Fructokinase (EC 2.7.1.4) Locus tag: BIFBRE_01711 Name: fruP Funciton: Predicted fructose transporter Locus tag: BIFBRE_01712 Name: fruP Funciton: Predicted fructose transporter
	BIFBRE_01709	fruR	Transcriptional regulator of fructose utilization, ROK family
	BIFBRE_01710	fruK	Fructokinase (EC 2.7.1.4)
	BIFBRE_01711	fruP	Predicted fructose transporter
	BIFBRE_01712	fruP	Predicted fructose transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD