Regulon of HxlR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_0009
Regulator family:	LacI
Regulation mode:
Biological process:	Hexulose metabolism
Effector:
Regulog:	HxlR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Hexulose metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 6.3 Sequence: GTAGTTAACCGGTAAACAAA Position: -97 Score: 6.3 Sequence: ATAGTTAACCGGTAAACGAA Locus tag: BDP_0010 Name: hxlP Funciton: Predicted hexulose permease Locus tag: BDP_0011 Name: usp Funciton: Predicted sugar phosphate isomerase/epimerase Locus tag: BDP_0012 Name: hxlK Funciton: Predicted hexulose kinase Locus tag: BDP_0013 Name: hxlA Funciton: 3-hexulose 6-phosphate formaldehyde-lyase Locus tag: BDP_0014 Name: hxlB Funciton: Predicted 6-phospho-3-hexuloisomerase
	BDP_0010	hxlP	Predicted hexulose permease
	BDP_0011	usp	Predicted sugar phosphate isomerase/epimerase
	BDP_0012	hxlK	Predicted hexulose kinase
	BDP_0013	hxlA	3-hexulose 6-phosphate formaldehyde-lyase
	BDP_0014	hxlB	Predicted 6-phospho-3-hexuloisomerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD