Regulon of HxlR in Bifidobacterium angulatum DSM 20098

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFANG_01236
Regulator family:	LacI
Regulation mode:
Biological process:	Hexulose metabolism
Effector:
Regulog:	HxlR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Hexulose metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -131 Score: 5.5 Sequence: GTAGTTAACCGGTACACATG Position: -96 Score: 5.6 Sequence: GTTGTTAACCGATAAACGTA Position: -83 Score: 5.5 Sequence: AAACGTAACCGGTAAACTAA Locus tag: BIFANG_01235 Name: hxlP Funciton: Predicted hexulose permease Locus tag: BIFANG_01234 Name: usp Funciton: Predicted sugar phosphate isomerase/epimerase Locus tag: BIFANG_01233 Name: hxlK Funciton: Predicted hexulose kinase Locus tag: BIFANG_01232 Name: hxlA Funciton: 3-hexulose 6-phosphate formaldehyde-lyase Locus tag: BIFANG_01231 Name: hxlB Funciton: Predicted 6-phospho-3-hexuloisomerase
	BIFANG_01235	hxlP	Predicted hexulose permease
	BIFANG_01234	usp	Predicted sugar phosphate isomerase/epimerase
	BIFANG_01233	hxlK	Predicted hexulose kinase
	BIFANG_01232	hxlA	3-hexulose 6-phosphate formaldehyde-lyase
	BIFANG_01231	hxlB	Predicted 6-phospho-3-hexuloisomerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD