Regulon of BLA_0143 in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_0129
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BLA_0143 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -110 Score: 6 Sequence: CTACTTAAGCGCTTAATATA Locus tag: BDP_0134 Name: null Funciton: alpha-galactosidase
	BDP_0134		alpha-galactosidase
Position: -98 Score: 6 Sequence: TATATTAAGCGCTTAAGTAG Locus tag: BDP_0133 Name: SSF53850 Funciton: Periplasmic binding protein-like II superfamily Locus tag: BDP_0132 Name: PF04854 Funciton: Protein of unknown function, DUF624
	BDP_0133	SSF53850	Periplasmic binding protein-like II superfamily
	BDP_0132	PF04854	Protein of unknown function, DUF624
Position: -44 Score: 5.1 Sequence: TTAAGTAATCGCTTAAGTTC Locus tag: BDP_0129 Name: BLA_0143 Funciton: Transcriptional regulator, LacI family
	BDP_0129	BLA_0143	Transcriptional regulator, LacI family
Position: -30 Score: 5.7 Sequence: TATCTTAACCGCTTCAGGAA Locus tag: BDP_0124 Name: null Funciton: Beta-glucosidase (EC 3.2.1.21)
	BDP_0124		Beta-glucosidase (EC 3.2.1.21)
Position: -88 Score: 5.7 Sequence: TGCATTAACCGCTTAAGTGA Locus tag: BDP_1538 Name: null Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
	BDP_1538		N-acylglucosamine 2-epimerase (EC 5.1.3.8)
Position: -162 Score: 5.4 Sequence: CAACTTAAGCGCTTGACAAA Locus tag: BDP_0125 Name: null Funciton: ABC transport system, sugar-binding component Locus tag: BDP_0126 Name: null Funciton: ABC-type sugar transport system, permease component Locus tag: BDP_0127 Name: null Funciton: ABC-type sugar transport system, permease component Locus tag: BDP_0128 Name: bmnA Funciton: Beta-mannosidase (EC 3.2.1.25)
	BDP_0125		ABC transport system, sugar-binding component
	BDP_0126		ABC-type sugar transport system, permease component
	BDP_0127		ABC-type sugar transport system, permease component
	BDP_0128	bmnA	Beta-mannosidase (EC 3.2.1.25)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD