Regulon of BLA_0143 in Bifidobacterium animalis subsp. lactis AD011

Properties
Regulator type:	Transcription factor
TF locus tag:	BLA_0143
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BLA_0143 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -224 Score: 5.9 Sequence: TATATTAAGCGGTTAAGTCA Locus tag: BLA_0145 Name: SSF53850 Funciton: Periplasmic binding protein-like II superfamily Locus tag: BLA_0144 Name: PF04854 Funciton: Protein of unknown function, DUF624
	BLA_0145	SSF53850	Periplasmic binding protein-like II superfamily
	BLA_0144	PF04854	Protein of unknown function, DUF624
Position: -199 Score: 5.7 Sequence: CGACTTAAGCGCTTCAGTGA Locus tag: BLA_0147 Name: null Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
	BLA_0147		N-acylglucosamine 2-epimerase (EC 5.1.3.8)
Position: -134 Score: 5.6 Sequence: GAACTTAAGCGCTTGATAAA Locus tag: BLA_0142 Name: bmnA Funciton: Beta-mannosidase (EC 3.2.1.25)
	BLA_0142	bmnA	Beta-mannosidase (EC 3.2.1.25)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD