Regulon of ZntR in Shewanella denitrificans OS217
| Regulator type: | Transcription factor |
| TF locus tag: | Sden_3408 |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Zinc resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Cadmium, ion (Cd2+) |
| Regulog: | ZntR - Shewanellaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - ZntR
- By TF family - MerR
- By effector - Zinc ion, (Zn2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Zinc resistance
- By pathway - Cadmium resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -72
Score: 7 Sequence: ACCTTAGATTAAACTCCAAGGT
Locus tag: Sden_3408
Name: zntR Funciton: Zinc resistance transcriptional regulator, MerR family
Locus tag: Sden_3409
Name: PF03773 Funciton: Putative permease of unknown function DUF318 |
|||
|
zntR
|
Zinc resistance transcriptional regulator, MerR family
|
||
|
PF03773
|
Putative permease of unknown function DUF318
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |