Regulon of ZntR in Shewanella baltica OS155

Properties
Regulator type:	Transcription factor
TF locus tag:	Sbal_0421
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Zinc resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Cadmium, ion (Cd2+)
Regulog:	ZntR - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - ZntR
By TF family - MerR
By effector - Zinc ion, (Zn2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Zinc resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -96 Score: 7 Sequence: ACCTTGGAGTAGGCTCCAAGGT Locus tag: Sbal_0421 Name: zntR Funciton: Zinc resistance transcriptional regulator, MerR family Locus tag: Sbal_0422 Name: PF03773 Funciton: Putative permease of unknown function DUF318
	Sbal_0421	zntR	Zinc resistance transcriptional regulator, MerR family
	Sbal_0422	PF03773	Putative permease of unknown function DUF318

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD