Regulon of EutR in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA5506
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 5 Sequence: AATGTAGTGAAAAAAACATT Locus tag: PA5506 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family Locus tag: PA5507 Name: COG1335 Funciton: Amidases related to nicotinamidase Locus tag: PA5508 Name: eutB Funciton: glutamine synthetase family protein Locus tag: PA5509 Name: eutA Funciton: putative N-formylglutamate amidohydrolase family protein Locus tag: PA5510 Name: eutT Funciton: Ethanolamine permease, APC family
	PA5506	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family
	PA5507	COG1335	Amidases related to nicotinamidase
	PA5508	eutB	glutamine synthetase family protein
	PA5509	eutA	putative N-formylglutamate amidohydrolase family protein
	PA5510	eutT	Ethanolamine permease, APC family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD