Regulog EutR - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Statistics of regulated genes
Genome	Genes	Operons
Azotobacter vinelandii AvOP
Pseudomonas aeruginosa PAO1	5	1
Pseudomonas entomophila L48
Pseudomonas fluorescens Pf-5	5	1
Pseudomonas mendocina ymp
Pseudomonas putida KT2440
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
eutR	Azotobacter vinelandii AvOP	* Pseudomonas aeruginosa PAO1 Site: position = -83 score = 5.03645 sequence = AATGTAGTGAAAAAAACATT Gene: PA5506: Transcriptional regulator of ethanolamine utilization, RpiR family	Pseudomonas entomophila L48	* Pseudomonas fluorescens Pf-5 Site: position = -77 score = 5.51523 sequence = CATGTAGCGTCTATTACATA Site: position = -38 score = 4.39573 sequence = TATGAAATAAAAACGACATC Gene: PFL_2247: Transcriptional regulator of ethanolamine utilization, RpiR family	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	Transcriptional regulator of ethanolamine utilization, RpiR family
COG1335	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1 Gene: PA5507: Amidases related to nicotinamidase	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5 Gene: PFL_2246: Amidases related to nicotinamidase	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	Amidases related to nicotinamidase
eutB	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1 Gene: PA5508: glutamine synthetase family protein	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5 Gene: PFL_2245: glutamine synthetase family protein	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	glutamine synthetase family protein
eutA	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1 Gene: PA5509: putative N-formylglutamate amidohydrolase family protein	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5 Gene: PFL_2244: putative N-formylglutamate amidohydrolase family protein	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	putative N-formylglutamate amidohydrolase family protein
eutT	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1 Gene: PA5510: Ethanolamine permease, APC family	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5 Gene: PFL_2243: Ethanolamine permease, APC family	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	Ethanolamine permease, APC family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog EutR - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --