Regulog EutR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | |
| Biological process: | Ethanolamine utilization |
| Effector: | Ethanolamine |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By TF family - RpiR
- By effector - Ethanolamine
- By pathway - Ethanolamine utilization
| Genome | Genes | Operons |
|---|---|---|
| Azotobacter vinelandii AvOP | ||
| Pseudomonas aeruginosa PAO1 | 5 | 1 |
| Pseudomonas entomophila L48 | ||
| Pseudomonas fluorescens Pf-5 | 5 | 1 |
| Pseudomonas mendocina ymp | ||
| Pseudomonas putida KT2440 | ||
| Pseudomonas stutzeri A1501 | ||
| Pseudomonas syringae pv. tomato str. DC3000 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| eutR |
|
*
Pseudomonas aeruginosa PAO1 Site: position = -83 score = 5.03645 sequence = AATGTAGTGAAAAAAACATT Gene: PA5506: Transcriptional regulator of ethanolamine utilization, RpiR family |
|
*
Pseudomonas fluorescens Pf-5 Site: position = -77 score = 5.51523 sequence = CATGTAGCGTCTATTACATA Site: position = -38 score = 4.39573 sequence = TATGAAATAAAAACGACATC Gene: PFL_2247: Transcriptional regulator of ethanolamine utilization, RpiR family |
|
|
|
|
Transcriptional regulator of ethanolamine utilization, RpiR family |
| COG1335 |
|
Gene: PA5507: Amidases related to nicotinamidase |
|
Gene: PFL_2246: Amidases related to nicotinamidase |
|
|
|
|
Amidases related to nicotinamidase |
| eutB |
|
Gene: PA5508: glutamine synthetase family protein |
|
Gene: PFL_2245: glutamine synthetase family protein |
|
|
|
|
glutamine synthetase family protein |
| eutA |
|
Gene: PA5509: putative N-formylglutamate amidohydrolase family protein |
|
Gene: PFL_2244: putative N-formylglutamate amidohydrolase family protein |
|
|
|
|
putative N-formylglutamate amidohydrolase family protein |
| eutT |
|
Gene: PA5510: Ethanolamine permease, APC family |
|
Gene: PFL_2243: Ethanolamine permease, APC family |
|
|
|
|
Ethanolamine permease, APC family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |