Regulon of EutR in Chromohalobacter salexigens DSM 3043

Properties
Regulator type:	Transcription factor
TF locus tag:	Csal_0674
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 4.8 Sequence: TTTGAAAAAATATTGACACG Locus tag: Csal_0675 Name: eutA Funciton: N-formylglutamate amidohydrolase Locus tag: Csal_0676 Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component Locus tag: Csal_0677 Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component Locus tag: Csal_0678 Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component Locus tag: Csal_0679 Name: eutB Funciton: glutamine synthetase family protein Locus tag: Csal_0680 Name: eutX Funciton: aldehyde dehydrogenase Locus tag: Csal_0681 Name: eutY Funciton: alcohol dehydrogenase
	Csal_0675	eutA	N-formylglutamate amidohydrolase
	Csal_0676	eutQ	TRAP-type ethanolamine transport system, small permease component
	Csal_0677	eutM	TRAP-type ethanolamine transport system, large permease component
	Csal_0678	eutP	TRAP-type ethanolamine transport system, periplasmic component
	Csal_0679	eutB	glutamine synthetase family protein
	Csal_0680	eutX	aldehyde dehydrogenase
	Csal_0681	eutY	alcohol dehydrogenase
Position: -84 Score: 4.8 Sequence: CGTGTCAATATTTTTTCAAA Locus tag: Csal_0674 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	Csal_0674	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD