Regulog EutR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | |
| Biological process: | Ethanolamine utilization |
| Effector: | Ethanolamine |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - RpiR
- By effector - Ethanolamine
- By pathway - Ethanolamine utilization
| Genome | Genes | Operons |
|---|---|---|
| Alcanivorax borkumensis SK2 | ||
| Cellvibrio japonicus Ueda107 | ||
| Chromohalobacter salexigens DSM 3043 | 8 | 2 |
| Hahella chejuensis KCTC 2396 | ||
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Marinomonas sp. MWYL1 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Reinekea sp. MED297 | ||
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| eutA |
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -64 score = 4.82138 sequence = TTTGAAAAAATATTGACACG Gene: Csal_0675: N-formylglutamate amidohydrolase |
|
|
|
|
|
|
|
|
|
N-formylglutamate amidohydrolase |
| eutQ |
|
|
Gene: Csal_0676: TRAP-type ethanolamine transport system, small permease component |
|
|
|
|
|
|
|
|
|
TRAP-type ethanolamine transport system, small permease component |
| eutM |
|
|
Gene: Csal_0677: TRAP-type ethanolamine transport system, large permease component |
|
|
|
|
|
|
|
|
|
TRAP-type ethanolamine transport system, large permease component |
| eutP |
|
|
Gene: Csal_0678: TRAP-type ethanolamine transport system, periplasmic component |
|
|
|
|
|
|
|
|
|
TRAP-type ethanolamine transport system, periplasmic component |
| eutB |
|
|
Gene: Csal_0679: glutamine synthetase family protein |
|
|
|
|
|
|
|
|
|
glutamine synthetase family protein |
| eutX |
|
|
Gene: Csal_0680: aldehyde dehydrogenase |
|
|
|
|
|
|
|
|
|
aldehyde dehydrogenase |
| eutY |
|
|
Gene: Csal_0681: alcohol dehydrogenase |
|
|
|
|
|
|
|
|
|
alcohol dehydrogenase |
| CRON 2. | |||||||||||||
| eutR |
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -84 score = 4.82138 sequence = CGTGTCAATATTTTTTCAAA Gene: Csal_0674: Transcriptional regulator of ethanolamine utilization, RpiR family |
|
|
|
|
|
|
|
|
|
Transcriptional regulator of ethanolamine utilization, RpiR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |