Regulon of AgaR2 in Enterococcus faecium DO

Properties
Regulator type:	Transcription factor
TF locus tag:	EfaeDRAFT_2711
Regulator family:	GntR/Others
Regulation mode:
Biological process:	N-acetylgalactosamine utilization
Effector:	N-acetylgalactosamine-6-phosphate
Regulog:	AgaR2 - Enterococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Enterococcaceae
By TF family - GntR/Others
By effector - N-acetylgalactosamine-6-phosphate
By pathway - N-acetylgalactosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 5 Sequence: ATTGTGGTTATAGCCAGTTA Locus tag: EfaeDRAFT_2711 Name: agaR2 Funciton: N-acetylgalactosamine utilization transcriptional regulator AgaR2, GntR family Locus tag: EfaeDRAFT_2712 Name: agaS Funciton: Predicted galactosamine-6-phosphate isomerase (EC 5.3.1.-) Locus tag: EfaeDRAFT_2713 Name: agaY Funciton: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
	EfaeDRAFT_2711	agaR2	N-acetylgalactosamine utilization transcriptional regulator AgaR2, GntR family
	EfaeDRAFT_2712	agaS	Predicted galactosamine-6-phosphate isomerase (EC 5.3.1.-)
	EfaeDRAFT_2713	agaY	Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD