Regulon of QorR in Streptomyces avermitilis MA-4680

Properties
Regulator type:	Transcription factor
TF locus tag:	SAV_4875
Regulator family:	HxlR
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:
Regulog:	QorR - Streptomycetaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By trascription factor - QorR
By TF family - HxlR
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6 Sequence: GCACTAACTCAGCGAAAGTAC Locus tag: SAV_4875 Name: qorR Funciton: Redox-sensing transcriptional regulator QorR, HxlR family
	SAV_4875	qorR	Redox-sensing transcriptional regulator QorR, HxlR family
Position: -66 Score: 6 Sequence: GTACTTTCGCTGAGTTAGTGC Locus tag: SAV_4874 Name: qorD Funciton: NADPH:quinone oxidoreductase 2, possible protective/detoxification role Locus tag: SAV_4873 Name: qorB Funciton: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
	SAV_4874	qorD	NADPH:quinone oxidoreductase 2, possible protective/detoxification role
	SAV_4873	qorB	Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD