Regulon of QorR in Arthrobacter chlorophenolicus A6

Properties
Regulator type:	Transcription factor
TF locus tag:	Achl_0580
Regulator family:	HxlR
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:
Regulog:	QorR - Micrococcineae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - QorR
By TF family - HxlR
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.8 Sequence: CGCACTTTGAAGTAAGGTACT Locus tag: Achl_0580 Name: qorR Funciton: Redox-sensing transcriptional regulator QorR, HxlR family
	Achl_0580	qorR	Redox-sensing transcriptional regulator QorR, HxlR family
Position: -94 Score: 5.8 Sequence: AGTACCTTACTTCAAAGTGCG Locus tag: Achl_0581 Name: qorB Funciton: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
	Achl_0581	qorB	Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD