Regulog QorR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By trascription factor - QorR
- By TF family - HxlR
- By pathway - Energy metabolism
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | ||
| Arthrobacter chlorophenolicus A6 | 2 | 2 |
| Arthrobacter sp. FB24 | ||
| Beutenbergia cavernae DSM 12333 | ||
| Brachybacterium faecium DSM 4810 | ||
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | 1 | 1 |
| Janibacter sp. HTCC2649 | 2 | 2 |
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | 1 | 1 |
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| qorR |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -62 score = 5.78654 sequence = CGCACTTTGAAGTAAGGTACT Gene: Achl_0580: Redox-sensing transcriptional regulator QorR, HxlR family |
|
|
|
|
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -34 score = 4.63907 sequence = CCCACTTTCTGGTAAGTTGTG Gene: CMM_2832: Redox-sensing transcriptional regulator QorR, HxlR family |
*
Janibacter sp. HTCC2649 Site: position = -42 score = 5.85147 sequence = CCCACTTTGAAGTAAGGTACG Gene: JNB_06539: Redox-sensing transcriptional regulator QorR, HxlR family |
|
|
|
|
|
|
Redox-sensing transcriptional regulator QorR, HxlR family |
| CRON 2. | |||||||||||||||
| qorB |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -94 score = 5.78654 sequence = AGTACCTTACTTCAAAGTGCG Gene: Achl_0581: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
|
|
|
|
*
Janibacter sp. HTCC2649 Site: position = -39 score = 5.85147 sequence = CGTACCTTACTTCAAAGTGGG Gene: JNB_06534: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
*
Kocuria rhizophila DC2201 Site: position = -92 score = 4.59885 sequence = AGTGCCTTACTGCGAAGTGCG Site: position = -35 score = 4.4713 sequence = TGTACCTTCCGTCAAGGACCC Gene: KRH_16940: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
|
|
|
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |