Regulon of SO1758 in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_1191
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO1758 - Shewanellaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]

Regulated operons
	Locus Tag	Name	Function
Position: -114 Score: 6.4 Sequence: GCTGACACCATGTTGTCAGC Locus tag: Sama_1190 Name: SO1756 Funciton: Glyoxalase family protein
	Sama_1190	SO1756	Glyoxalase family protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD