Regulog SO1758 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - [Other]
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 1 | 1 |
| Shewanella putrefaciens CN-32 | 1 | 1 |
| Shewanella sp W3-18-1 | 1 | 1 |
| Shewanella sp ANA-3 | 1 | 1 |
| Shewanella sp MR-4 | 1 | 1 |
| Shewanella sp MR-7 | 1 | 1 |
| Shewanella baltica OS155 | 1 | 1 |
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | 1 | 1 |
| Shewanella loihica PV-4 | 1 | 1 |
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | 1 | 1 |
| Shewanella woodyi ATCC 51908 | 1 | 1 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO1756 |
*
Shewanella oneidensis MR-1 Site: position = -104 score = 6.8068 sequence = ACTGACATGATGCTGTCAGT Gene: SO_1756: Glyoxalase family protein |
*
Shewanella putrefaciens CN-32 Site: position = -122 score = 7.028 sequence = ACTGACATCATGCTGTCAGT Gene: Sputcn32_1455: Glyoxalase family protein |
*
Shewanella sp W3-18-1 Site: position = -122 score = 7.028 sequence = ACTGACATCATGCTGTCAGT Gene: Sputw3181_2647: Glyoxalase family protein |
*
Shewanella sp ANA-3 Site: position = -110 score = 6.70071 sequence = ACTGACATGATGTTGTCAGT Gene: Shewana3_2706: Glyoxalase family protein |
*
Shewanella sp MR-4 Site: position = -110 score = 6.70071 sequence = ACTGACATGATGTTGTCAGT Gene: Shewmr4_2540: Glyoxalase family protein |
*
Shewanella sp MR-7 Site: position = -110 score = 6.70071 sequence = ACTGACATGATGTTGTCAGT Gene: Shewmr7_2607: Glyoxalase family protein |
*
Shewanella baltica OS155 Site: position = -121 score = 7.028 sequence = ACTGACATCATGCTGTCAGT Gene: Sbal_1562: Glyoxalase family protein |
|
|
*
Shewanella amazonensis SB2B Site: position = -114 score = 6.40294 sequence = GCTGACACCATGTTGTCAGC Gene: Sama_1190: Glyoxalase family protein |
*
Shewanella loihica PV-4 Site: position = -105 score = 6.45551 sequence = ACTGACACTAGGCTGTCAGT Gene: Shew_2543: Glyoxalase family protein |
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -71 score = 6.45551 sequence = ACTGACACTACGCTGTCAGT Gene: Ssed_2787: Glyoxalase family protein |
*
Shewanella woodyi ATCC 51908 Site: position = -100 score = 6.7614 sequence = ACTGACACTATGGTGTCAGT Gene: Swoo_3144: Glyoxalase family protein |
Glyoxalase family protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |