Regulon of MlnR in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	Reut_A0644
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Regulog:	MlnR - Ralstonia
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - GntR/Others
By pathway - Malonate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 6.5 Sequence: TCATCCATAATTATGAATTA Locus tag: Reut_A0644 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: Reut_A0645 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: Reut_A0646 Name: h16_A2980 Funciton: putative exported protein Locus tag: Reut_A0647 Name: h16_A2979 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase Locus tag: Reut_A0648 Name: matB Funciton: Malonyl-CoA ligase (EC 6.2.1.3)
	Reut_A0644	mlnR	Transcriptional regulator of malonate metabolism, GntR family
	Reut_A0645	matA	Malonyl-CoA decarboxylase
	Reut_A0646	h16_A2980	putative exported protein
	Reut_A0647	h16_A2979	methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase
	Reut_A0648	matB	Malonyl-CoA ligase (EC 6.2.1.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD