Regulon of MlnR in Ralstonia eutropha H16

Properties
Regulator type:	Transcription factor
TF locus tag:	H16_A2982
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Regulog:	MlnR - Ralstonia
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - GntR/Others
By pathway - Malonate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 6.6 Sequence: TAATCCATAATTATGAATTA Locus tag: H16_A2982 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: H16_A2981 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: H16_A2980 Name: h16_A2980 Funciton: putative exported protein Locus tag: H16_A2979 Name: h16_A2979 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase Locus tag: H16_A2978 Name: matB Funciton: Malonyl-CoA ligase (EC 6.2.1.3)
	H16_A2982	mlnR	Transcriptional regulator of malonate metabolism, GntR family
	H16_A2981	matA	Malonyl-CoA decarboxylase
	H16_A2980	h16_A2980	putative exported protein
	H16_A2979	h16_A2979	methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase
	H16_A2978	matB	Malonyl-CoA ligase (EC 6.2.1.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD