Regulon of SdaR in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_1518
Regulator family:	SdaR
Regulation mode:	repressor
Biological process:	Glycerate utilization
Effector:	Glycerate
Regulog:	SdaR - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - SdaR
By TF family - SdaR
By effector - Glycerate
By pathway - Glycerate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -203 Score: 6.7 Sequence: TTTTGTGCATACGCACAAAA Locus tag: Ssed_2778 Name: grtP Funciton: D-glycerate transporter, GntP family Locus tag: Ssed_2779 Name: garK Funciton: Glycerate kinase (EC 2.7.1.31)
	Ssed_2778	grtP	D-glycerate transporter, GntP family
	Ssed_2779	garK	Glycerate kinase (EC 2.7.1.31)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD