Regulon of UriR in Enterococcus faecalis V583

Properties
Regulator type:	Transcription factor
TF locus tag:	EF0172
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Nucleoside utilization
Effector:	Pyrimidine nucleoside
Regulog:	UriR - Enterococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Enterococcaceae
By TF family - LacI
By effector - Pyrimidine nucleoside
By pathway - Nucleoside utilization

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.7 Sequence: ATAGTAAACTGGTTTACTAA Locus tag: EF0173 Name: pdp Funciton: Pyrimidine-nucleoside phosphorylase (EC 2.4.2.2) Locus tag: EF0174 Name: deoC Funciton: Deoxyribose-phosphate aldolase (EC 4.1.2.4) Locus tag: EF0175 Name: cdd Funciton: Cytidine deaminase (EC 3.5.4.5) Locus tag: EF0176 Name: EF0177 Funciton: Predicted nucleoside ABC transporter, substrate-binding component Locus tag: EF0177 Name: EF0177 Funciton: Predicted nucleoside ABC transporter, substrate-binding component
	EF0173	pdp	Pyrimidine-nucleoside phosphorylase (EC 2.4.2.2)
	EF0174	deoC	Deoxyribose-phosphate aldolase (EC 4.1.2.4)
	EF0175	cdd	Cytidine deaminase (EC 3.5.4.5)
	EF0176	EF0177	Predicted nucleoside ABC transporter, substrate-binding component
	EF0177	EF0177	Predicted nucleoside ABC transporter, substrate-binding component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD